Skip to main content
Addgene

act-3p(long):rfp
(Plasmid #202330)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 202330 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBR332
  • Backbone size w/o insert (bp) 2647
  • Total vector size (bp) 7460
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    act-3p(long) promoter
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    4046
  • GenBank ID
    WBGene00000065
  • Promoter This is a promoter sequence for C. elegans act-3

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAGGAAACAGCTATGAC
  • 3′ sequencing primer TGTTCACGGTGCCCTCC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    TurboRFP
  • Species
    Entacmaea quadricolor
  • Insert Size (bp)
    696
  • Promoter act-3p(long) promoter

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site XmaI (not destroyed)
  • 3′ cloning site SacI (not destroyed)
  • 5′ sequencing primer TCAAATTCGTGTTCTTTTCCAA
  • 3′ sequencing primer cagggttttcccagtcacgacg
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    act-3p(long):rfp was a gift from Didier Stainier (Addgene plasmid # 202330 ; http://n2t.net/addgene:202330 ; RRID:Addgene_202330)
  • For your References section:

    Partial sequence identity in a 25-nucleotide long element is sufficient for transcriptional adaptation in the Caenorhabditis elegans act-5/act-3 model. Welker JM, Serobyan V, Zaker Esfahani E, Stainier DYR. PLoS Genet. 2023 Jun 29;19(6):e1010806. doi: 10.1371/journal.pgen.1010806. eCollection 2023 Jun. 10.1371/journal.pgen.1010806 PubMed 37384903