act-3p(long):rfp
(Plasmid
#202330)
-
PurposeThe act-3 promoter drives expression of TurboRFP in the pharynx, spermatheca, and body wall of C. elegans.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 202330 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBR332
- Backbone size w/o insert (bp) 2647
- Total vector size (bp) 7460
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameact-3p(long) promoter
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)4046
-
GenBank IDWBGene00000065
- Promoter This is a promoter sequence for C. elegans act-3
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGGAAACAGCTATGAC
- 3′ sequencing primer TGTTCACGGTGCCCTCC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameTurboRFP
-
SpeciesEntacmaea quadricolor
-
Insert Size (bp)696
- Promoter act-3p(long) promoter
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site XmaI (not destroyed)
- 3′ cloning site SacI (not destroyed)
- 5′ sequencing primer TCAAATTCGTGTTCTTTTCCAA
- 3′ sequencing primer cagggttttcccagtcacgacg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
act-3p(long):rfp was a gift from Didier Stainier (Addgene plasmid # 202330 ; http://n2t.net/addgene:202330 ; RRID:Addgene_202330) -
For your References section:
Partial sequence identity in a 25-nucleotide long element is sufficient for transcriptional adaptation in the Caenorhabditis elegans act-5/act-3 model. Welker JM, Serobyan V, Zaker Esfahani E, Stainier DYR. PLoS Genet. 2023 Jun 29;19(6):e1010806. doi: 10.1371/journal.pgen.1010806. eCollection 2023 Jun. 10.1371/journal.pgen.1010806 PubMed 37384903