pLenti-EF1a-MTS-FLAG-LOV*
(Plasmid #202208)

• Purpose: Plasmid for the generation of a lentiviral vector encoding the photoproximity labeling catalyst LOV* fused to the mitochondria targeting sequence (MTS) in mammalian cells
• Depositing Lab: Thomas Muir
• Publication: Hananya et al Proc Natl Acad Sci U S A. 2023 Apr 18;120(16):e2219339120. doi: 10.1073/pnas.2219339120. Epub 2023 Apr 10.

Backbone

• Vector backbone: pLenti
• Backbone size w/o insert (bp): 8000
• Total vector size (bp): 8400
• Vector type: Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cytochrome c oxidase subunit 4 isoform 1, mitochondrial, aa 1-24
• Alt name: Mitochondria targeting sequence
• Species: H. sapiens (human)
• Insert Size (bp): 432
• Promoter: Ef1a
• Tags / Fusion Proteins:
  • FLAG (C terminal on insert)
  • LOV* (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCACACTGAGTGGGTGGAGACTG
• 3′ sequencing primer: CAGAGGAACTGCTTCCTTCACGAC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry