Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLenti-EF1a-MTS-FLAG-LOV*
(Plasmid #202208)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 202208 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pLenti
  • Backbone size w/o insert (bp) 8000
  • Total vector size (bp) 8400
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cytochrome c oxidase subunit 4 isoform 1, mitochondrial, aa 1-24
  • Alt name
    Mitochondria targeting sequence
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    432
  • Promoter Ef1a
  • Tags / Fusion Proteins
    • FLAG (C terminal on insert)
    • LOV* (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CCACACTGAGTGGGTGGAGACTG
  • 3′ sequencing primer CAGAGGAACTGCTTCCTTCACGAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-EF1a-MTS-FLAG-LOV* was a gift from Thomas Muir (Addgene plasmid # 202208 ; http://n2t.net/addgene:202208 ; RRID:Addgene_202208)
  • For your References section:

    A genetically encoded photoproximity labeling approach for mapping protein territories. Hananya N, Ye X, Koren S, Muir TW. Proc Natl Acad Sci U S A. 2023 Apr 18;120(16):e2219339120. doi: 10.1073/pnas.2219339120. Epub 2023 Apr 10. 10.1073/pnas.2219339120 PubMed 37036999