pCMV-FLAG-LOV*-MVP
(Plasmid #202206)

• Purpose: Expresses the photoproximity labeling catalyst LOV* fused to MVP in mammalian cells
• Depositing Lab: Thomas Muir
• Publication: Hananya et al Proc Natl Acad Sci U S A. 2023 Apr 18;120(16):e2219339120. doi: 10.1073/pnas.2219339120. Epub 2023 Apr 10.

Backbone

• Vector backbone: pCMV
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 7000
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Major vault protein
• Alt name: MVP
• Species: H. sapiens (human)
• Insert Size (bp): 3063
• Entrez Gene: MVP (a.k.a. LRP, VAULT1)
• Promoter: CMV
• Tags / Fusion Proteins:
  • FLAG (N terminal on insert)
  • LOV* (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: GAAATTTGTGATGCTATTGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry