pCMV-PDK1-FLAG-LOV*
(Plasmid #202205)

• Purpose: Expresses the photoproximity labeling catalyst LOV* fused to PDK1 in mammalian cells
• Depositing Lab: Thomas Muir
• Publication: Hananya et al Proc Natl Acad Sci U S A. 2023 Apr 18;120(16):e2219339120. doi: 10.1073/pnas.2219339120. Epub 2023 Apr 10.

Backbone

• Vector backbone: pCMV
• Backbone size w/o insert (bp): 4000
• Total vector size (bp): 5600
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: [Pyruvate dehydrogenase (acetyl-transferring)] kinase isozyme 1, mitochondrial
• Alt name: PDK1
• Species: H. sapiens (human)
• Insert Size (bp): 1665
• Entrez Gene: PDK1
• Promoter: CMV
• Tags / Fusion Proteins:
  • FLAG (C terminal on insert)
  • LOV* (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: GAAATTTGTGATGCTATTGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry