pCMV-FLAG-LOV*-H2B
(Plasmid
#202204)
-
PurposeExpresses the photoproximity labeling catalyst LOV* fused to H2B in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 202204 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 4000
- Total vector size (bp) 4700
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHistone H2B type 1-K
-
Alt nameH2B
-
SpeciesH. sapiens (human)
-
Insert Size (bp)747
- Promoter CMV
-
Tags
/ Fusion Proteins
- FLAG (N terminal on insert)
- LOV* (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-FLAG-LOV*-H2B was a gift from Thomas Muir (Addgene plasmid # 202204 ; http://n2t.net/addgene:202204 ; RRID:Addgene_202204) -
For your References section:
A genetically encoded photoproximity labeling approach for mapping protein territories. Hananya N, Ye X, Koren S, Muir TW. Proc Natl Acad Sci U S A. 2023 Apr 18;120(16):e2219339120. doi: 10.1073/pnas.2219339120. Epub 2023 Apr 10. 10.1073/pnas.2219339120 PubMed 37036999