Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

hSyn-GW-dCas9-SET2-R195G-C201A-IRES2-mCherry
(Plasmid #202090)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 202090 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    hSyn-GW-IRES2-mCherry
  • Backbone size w/o insert (bp) 8173
  • Total vector size (bp) 14710
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9-Set2(R195G, C201A)
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    6537
  • Mutation
    R195G and C201A abolish catalytic activity
  • Promoter human Synapsin
  • Tags / Fusion Proteins
    • 3x FLAG (N terminal on insert)
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer GATAGTGACCTGTTCGTTGC
  • 3′ sequencing primer CCAACTTTGTACAAGAAAGCTGGGTC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hSyn-GW-dCas9-SET2-R195G-C201A-IRES2-mCherry was a gift from Elizabeth Heller (Addgene plasmid # 202090 ; http://n2t.net/addgene:202090 ; RRID:Addgene_202090)
  • For your References section:

    Chromatin-mediated alternative splicing regulates cocaine-reward behavior. Xu SJ, Lombroso SI, Fischer DK, Carpenter MD, Marchione DM, Hamilton PJ, Lim CJ, Neve RL, Garcia BA, Wimmer ME, Pierce RC, Heller EA. Neuron. 2021 Sep 15;109(18):2943-2966.e8. doi: 10.1016/j.neuron.2021.08.008. Epub 2021 Sep 3. 10.1016/j.neuron.2021.08.008 PubMed 34480866