pBVboostFGII WPRE 3C-CVB3
(Plasmid #202077)

• Purpose: Bacterial expression of 3C protease from coxsackievirus B3 (CVB3). Contains C-terminal His6-tag.
• Depositing Lab: Vesa Hytönen
• Publication: Jouppila et al Microbiol Spectr. 2023 Jun 15;11(3):e0535222. doi: 10.1128/spectrum.05352-22. Epub 2023 May 25.

Backbone

• Vector backbone: pBVboostFGII WPRE
• Backbone manufacturer: Dept of Molec Med and Biotech, A.I. Virtanen Institute, University of Kuopio, PO Box 1627 FIN-70211, Kuopio, Finland
• Backbone size w/o insert (bp): 9972
• Vector type: Mammalian Expression, Bacterial Expression, Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Gentamicin, 10 μg/mL
• Growth Temperature: Room Temperature
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: CVB3 3C protease with HisTag
• Species: Synthetic
• Insert Size (bp): 576
• Promoter: polh, CAG, T7
• Tag / Fusion Protein:
  • 6xHis-tag (C terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CAATCAAAGGAGATATACCACG
• 3′ sequencing primer: TCGACCTGCAGGCGCGCCGA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Insert cloned to plasmid with attL1 and attL2 sites