Skip to main content
Addgene

pBVboostFGII WPRE 3C-CVB3
(Plasmid #202077)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 202077 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBVboostFGII WPRE
  • Backbone manufacturer
    Dept of Molec Med and Biotech, A.I. Virtanen Institute, University of Kuopio, PO Box 1627 FIN-70211, Kuopio, Finland
  • Backbone size w/o insert (bp) 9972
  • Vector type
    Mammalian Expression, Bacterial Expression, Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    Room Temperature
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CVB3 3C protease with HisTag
  • Species
    Synthetic
  • Insert Size (bp)
    576
  • Promoter polh, CAG, T7
  • Tag / Fusion Protein
    • 6xHis-tag (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CAATCAAAGGAGATATACCACG
  • 3′ sequencing primer TCGACCTGCAGGCGCGCCGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Insert cloned to plasmid with attL1 and attL2 sites

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBVboostFGII WPRE 3C-CVB3 was a gift from Vesa Hytönen (Addgene plasmid # 202077 ; http://n2t.net/addgene:202077 ; RRID:Addgene_202077)
  • For your References section:

    Assessment of Enterovirus Antibodies during Early Childhood Using a Multiplex Immunoassay. Jouppila NVV, Lehtonen J, Seppala E, Puustinen L, Oikarinen S, Laitinen OH, Knip M, Hyoty H, Hytonen VP. Microbiol Spectr. 2023 Jun 15;11(3):e0535222. doi: 10.1128/spectrum.05352-22. Epub 2023 May 25. 10.1128/spectrum.05352-22 PubMed 37227147