V5-LOV-Turbo1-G3BP1_pTRE-G418
(Plasmid #202015)

• Purpose: expresses LOV-Turbo1-G3BP1 in the mammalian cytosol under dox inducible promoter, lentiviral vector
• Depositing Lab: Alice Ting
• Publication: Qin et al Cell. 2023 Jun 23:S0092-8674(23)00596-2. doi: 10.1016/j.cell.2023.05.044.

Backbone

• Vector backbone: pTRE
• Total vector size (bp): 10189
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Gentamicin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: V5-LOV-Turbo1-G3BP1
• Species: Synthetic
• Insert Size (bp): 2846
• Promoter: pTRE-Tight
• Tag / Fusion Protein:
  • V5 (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gcagagctcgtttagtgaaccg

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/2023.02.07.527548v1 for bioRxiv preprint