APEX2-V5-G3BP1_pTRE-G418
(Plasmid
#202013)
-
Purposeexpresses APEX2-G3BP1 in the mammalian cytosol under dox inducible promoter, lentiviral vector
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 202013 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepTRE
- Total vector size (bp) 9587
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAPEX2-V5-G3BP1
-
SpeciesSynthetic
-
Insert Size (bp)2205
- Promoter pTRE-Tight
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcagagctcgtttagtgaaccg (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.02.07.527548v1 for bioRxiv preprint
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
APEX2-V5-G3BP1_pTRE-G418 was a gift from Alice Ting (Addgene plasmid # 202013 ; http://n2t.net/addgene:202013 ; RRID:Addgene_202013) -
For your References section:
Dynamic mapping of proteome trafficking within and between living cells by TransitID. Qin W, Cheah JS, Xu C, Messing J, Freibaum BD, Boeynaems S, Taylor JP, Udeshi ND, Carr SA, Ting AY. Cell. 2023 Jun 23:S0092-8674(23)00596-2. doi: 10.1016/j.cell.2023.05.044. 10.1016/j.cell.2023.05.044 PubMed 37385249
