pMOD_D-CmYLCV-NbGP41P-sfGFP-VP64-GB1
(Plasmid
#202010)
-
PurposeMoclo level 1 - Module D, Promoter: CmYLCV, Gene: NbGP41P-sfGFP-VP64-GB1, Terminator: ZmUBI
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 202010 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepJC228
- Backbone size w/o insert (bp) 2019
- Total vector size (bp) 5083
-
Vector typeSynthetic Biology ; MoClo level 1 vector
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNbGP41P-sfGFP-VP64-GB1
-
SpeciesSynthetic; Lama glama, herpes simplex virus
- Promoter CmYLCV
-
Tags
/ Fusion Proteins
- sfGFP
- GB1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer gcgagtcagtgagcgaggaagc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMOD_D-CmYLCV-NbGP41P-sfGFP-VP64-GB1 was a gift from Michael Smanski (Addgene plasmid # 202010 ; http://n2t.net/addgene:202010 ; RRID:Addgene_202010) -
For your References section:
Efficient gene activation in plants by the MoonTag programmable transcriptional activator. Casas-Mollano JA, Zinselmeier M, Sychla A, Smanski MJ. Nucleic Acids Research, Volume 51, Issue 13, 21 July 2023, Pages 7083–7093 10.1101/2023.02.15.528671 PubMed 36824723