Skip to main content
Addgene

pMOD_D-CmYLCV-NbGP41P-sfGFP-VP64-GB1
(Plasmid #202010)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 202010 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pJC228
  • Backbone size w/o insert (bp) 2019
  • Total vector size (bp) 5083
  • Vector type
    Synthetic Biology ; MoClo level 1 vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NbGP41P-sfGFP-VP64-GB1
  • Species
    Synthetic; Lama glama, herpes simplex virus
  • Promoter CmYLCV
  • Tags / Fusion Proteins
    • sfGFP
    • GB1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer gcgagtcagtgagcgaggaagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMOD_D-CmYLCV-NbGP41P-sfGFP-VP64-GB1 was a gift from Michael Smanski (Addgene plasmid # 202010 ; http://n2t.net/addgene:202010 ; RRID:Addgene_202010)
  • For your References section:

    Efficient gene activation in plants by the MoonTag programmable transcriptional activator. Casas-Mollano JA, Zinselmeier M, Sychla A, Smanski MJ. Nucleic Acids Research, Volume 51, Issue 13, 21 July 2023, Pages 7083–7093 10.1101/2023.02.15.528671 PubMed 36824723