Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMOD_A-CmYLCV-dCas9-24XGP41
(Plasmid #202009)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 202009 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pJC224
  • Backbone size w/o insert (bp) 2019
  • Total vector size (bp) 8527
  • Vector type
    Synthetic Biology ; MoClo level 1 vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dCas9-24XGP41
  • Species
    Synthetic; Streptococcus pyogenes
  • Promoter CmYLCV
  • Tag / Fusion Protein
    • GS linkers

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer gcgagtcagtgagcgaggaagc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMOD_A-CmYLCV-dCas9-24XGP41 was a gift from Michael Smanski (Addgene plasmid # 202009 ; http://n2t.net/addgene:202009 ; RRID:Addgene_202009)
  • For your References section:

    Efficient gene activation in plants by the MoonTag programmable transcriptional activator. Casas-Mollano JA, Zinselmeier M, Sychla A, Smanski MJ. Nucleic Acids Research, Volume 51, Issue 13, 21 July 2023, Pages 7083–7093 10.1101/2023.02.15.528671 PubMed 36824723