Skip to main content
Addgene

CROP-seq-opti-dsRed
(Plasmid #201999)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201999 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    CROP-seq-opti
  • Backbone size (bp) 10293
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Promoter EF1a
  • Tag / Fusion Protein
    • dsRed (N terminal on insert)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer TTTCCCATGATTCCTTCATATTTGC
  • 3′ sequencing primer CTGTTTCCAGCATAGCTCTTAAAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CROP-seq-opti-dsRed was a gift from Daniel Geschwind (Addgene plasmid # 201999 ; http://n2t.net/addgene:201999 ; RRID:Addgene_201999)