Skip to main content
Addgene

pAAV-TRE-IEo
(Plasmid #201992)

Ordering

This material is available to academics and nonprofits only. Orders shipped outside the U.S. may require additional regulatory approval, as well as a non-refundable export license fee of $85. Please log in to view availability.
Item Catalog # Description Quantity Price (USD)
Plasmid 201992 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    AAV2
  • Backbone manufacturer
    3358
  • Total vector size (bp) 7720
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Inducible expression of codon optimized immediate early gene IE180 of pseudorabies virus
  • Species
    Synthetic
  • Insert Size (bp)
    4362
  • GenBank ID
    Will provide once we obtain it
  • Promoter Tight TRE

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer cgtatgtcgaggtaggcgtgtacgg
  • 3′ sequencing primer ataagatacattgatgagtttgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-TRE-IEo was a gift from Wei Xu (Addgene plasmid # 201992 ; http://n2t.net/addgene:201992 ; RRID:Addgene_201992)
  • For your References section:

    Directed stepwise tracing of polysynaptic neuronal circuits with replication-deficient pseudorabies virus. Du W, Li E, Guo J, Arano R, Kim Y, Chen YT, Thompson A, Oh SJ, Samuel A, Li Y, Oyibo HK, Xu W. Cell Rep Methods. 2023 Jun 16;3(6):100506. doi: 10.1016/j.crmeth.2023.100506. eCollection 2023 Jun 26. 10.1016/j.crmeth.2023.100506 PubMed 37426757