pegRNA_HEK4_1bp-deletion
(Plasmid
#201976)
-
PurposeExpress a pegRNA used for 1bp deletion at HEK4 site
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 201976 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepmd127 pLKO.1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepegRNA_HEK4
-
gRNA/shRNA sequenceGGCACTGCGGCTGGAGGTGG
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pegRNA_HEK4_1bp-deletion was a gift from Scot Wolfe (Addgene plasmid # 201976 ; http://n2t.net/addgene:201976 ; RRID:Addgene_201976) -
For your References section:
Genome-wide profiling of prime editor off-target sites in vitro and in vivo using PE-tag. Liang SQ, Liu P, Ponnienselvan K, Suresh S, Chen Z, Kramme C, Chatterjee P, Zhu LJ, Sontheimer EJ, Xue W, Wolfe SA. Nat Methods. 2023 Jun;20(6):898-907. doi: 10.1038/s41592-023-01859-2. Epub 2023 May 8. 10.1038/s41592-023-01859-2 PubMed 37156841