Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBEL2108
(Plasmid #201969)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201969 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pKM468-EGFP
  • Vector type
    ORBIT integrating plasmid

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    attB-3C-eGFP-4xGly-TEV-Flag-6xHis
  • Species
    Synthetic

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAGGAACTGGCGCAGTTCCTCTGG
  • 3′ sequencing primer CCTGGTATCTTTATAGTCCTGTCG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Kenan Murphy (source of pKM468-EGFP plasmid (Addgene plasmid # 108434))

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBEL2108 was a gift from Gira Bhabha & Damian Ekiert (Addgene plasmid # 201969 ; http://n2t.net/addgene:201969 ; RRID:Addgene_201969)
  • For your References section:

    Structure of an endogenous mycobacterial MCE lipid transporter. Chen J, Fruhauf A, Fan C, Ponce J, Ueberheide B, Bhabha G, Ekiert D. Res Sq. 2023 Jan 10:rs.3.rs-2412186. doi: 10.21203/rs.3.rs-2412186/v1. Preprint. 10.21203/rs.3.rs-2412186/v1 PubMed 36711512