pBEL2108
(Plasmid
#201969)
-
PurposeORBIT integrating plasmid for C-terminal tagging with eGFP containing a 3C protease cleavage site.
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 201969 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepKM468-EGFP
-
Vector typeORBIT integrating plasmid
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameattB-3C-eGFP-4xGly-TEV-Flag-6xHis
-
SpeciesSynthetic
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGGAACTGGCGCAGTTCCTCTGG
- 3′ sequencing primer CCTGGTATCTTTATAGTCCTGTCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byKenan Murphy (source of pKM468-EGFP plasmid (Addgene plasmid # 108434))
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.12.08.519548v2.full for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBEL2108 was a gift from Gira Bhabha & Damian Ekiert (Addgene plasmid # 201969 ; http://n2t.net/addgene:201969 ; RRID:Addgene_201969) -
For your References section:
Structure of an endogenous mycobacterial MCE lipid transporter. Chen J, Fruhauf A, Fan C, Ponce J, Ueberheide B, Bhabha G, Ekiert D. Res Sq. 2023 Jan 10:rs.3.rs-2412186. doi: 10.21203/rs.3.rs-2412186/v1. Preprint. 10.21203/rs.3.rs-2412186/v1 PubMed 36711512