Skip to main content
Addgene

PX458-3xHA-SpCas9-HF1
(Plasmid #201952)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201952 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    PX458
  • Backbone size w/o insert (bp) 4237
  • Total vector size (bp) 9310
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    EGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Mammalian expression plasmid of high-fidelity SpCas9 variant SpCas9-HF1 with T2A-EGFP and cloning backbone for sgRNA
  • Species
    Synthetic
  • Insert Size (bp)
    5070
  • Promoter Cbh
  • Tags / Fusion Proteins
    • 3xHA (N terminal on insert)
    • NLS (N terminal on insert)
    • NLS (C terminal on insert)
    • T2A-EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site FseI (not destroyed)
  • 5′ sequencing primer CTCCGGGCTGTAATTAGCTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PX458-3xHA-SpCas9-HF1 was a gift from Debojyoti Chakraborty (Addgene plasmid # 201952 ; http://n2t.net/addgene:201952 ; RRID:Addgene_201952)
  • For your References section:

    PAM-flexible Engineered FnCas9 variants for robust and ultra-precise genome editing and diagnostics. Acharya S, Ansari AH, Kumar Das P, Hirano S, Aich M, Rauthan R, Mahato S, Maddileti S, Sarkar S, Kumar M, Phutela R, Gulati S, Rahman A, Goel A, Afzal C, Paul D, Agrawal T, Pulimamidi VK, Jalali S, Nishimasu H, Mariappan I, Nureki O, Maiti S, Chakraborty D. Nat Commun. 2024 Jun 28;15(1):5471. doi: 10.1038/s41467-024-49233-w. 10.1038/s41467-024-49233-w PubMed 38942756