Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

PX458-3xHA-en15FnCas9
(Plasmid #201948)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 201948 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    PX458
  • Backbone size w/o insert (bp) 4233
  • Total vector size (bp) 10089
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    EGFP

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    3xHA-NLS-en15FnCas9-T2A-EGFP
  • Species
    Synthetic
  • Insert Size (bp)
    5856
  • Mutation
    E1603H on FnCas9
  • Promoter Cbh
  • Tags / Fusion Proteins
    • 3xHA (N terminal on insert)
    • NLS (N terminal on insert)
    • NLS (C terminal on insert)
    • T2A-EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site FseI (not destroyed)
  • 5′ sequencing primer CTCCGGGCTGTAATTAGCTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PX458-3xHA-en15FnCas9 was a gift from Debojyoti Chakraborty (Addgene plasmid # 201948 ; http://n2t.net/addgene:201948 ; RRID:Addgene_201948)
  • For your References section:

    Engineered FnCas9 variants for robust and ultra-precise genome editing and diagnostics. Acharya S, Ansari AH, Kumar Das P, Hirano S, Aich M, Rauthan R, Mahato S, Maddileti S, Sarkar S, Kumar M, Phutela R, Gulati S, Rahman A, Goel A, Afzal C, Paul D, Agrawal T, Kumar Pulimamidi V, Jalali S, Nishimasu H, Mariappan I, Nureki O, Maiti S, Chakraborty D. Nat Commun. 2024 15:5471 DOI: 10.1038/s41467-024-49233-w 10.1038/s41467-024-49233-w