pAG416GAL-EMCV_3C
(Plasmid
#201941)
-
PurposeExpresses EMCV 3C protease from a GAL promoter with a URA3 marker
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 201941 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepAG416GAL-ccdB
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEMCV 3C protease
-
Alt nameEncephalomyocarditis virus 3C protease
-
Entrez GeneEMCVgp1 (a.k.a. EMCVgp1)
- Promoter GAL1
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TCAAATGTAATAAAAGTATCAACAAAA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG416GAL-EMCV_3C was a gift from Alejandro Chavez (Addgene plasmid # 201941 ; http://n2t.net/addgene:201941 ; RRID:Addgene_201941)
