pCDF-Frb-v1
(Plasmid #201923)

• Purpose: E. coli vector expressing FrbA, FrbB, FrbC, FrbD and FrbE for the biosynthesis of non-hydrolyzable phosphoserine from phosphoenolpyruvate.
• Depositing Labs: Richard Cooley, Ryan Mehl
• Publication: Zhu et al ACS Cent Sci. 2023 Apr 10;9(4):816-835. doi: 10.1021/acscentsci.3c00191. eCollection 2023 Apr 26.

Backbone

• Vector backbone: pCDF
• Total vector size (bp): 11331
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: FrbA
• Species: Streptomyces rubellomurinus
• Insert Size (bp): 2664
• GenBank ID: WP_045699988
• Promoter: T7 (modified, weak)

Cloning Information for Gene/Insert 1

• Cloning method: Gateway Cloning
• 5′ sequencing primer: CCATACCGCGAAAGGTTTTGCG

Gene/Insert 2

• Gene/Insert name: FrbB
• Species: Streptomyces rubellomurinus
• Insert Size (bp): 1062
• GenBank ID: WP_045699989
• Promoter: T7 (modified, moderate)

Cloning Information for Gene/Insert 2

• Cloning method: Gateway Cloning
• 5′ sequencing primer: GTCGGACCTCTTAGACGCCG

Gene/Insert 3

• Gene/Insert name: FrbC
• Species: Streptomyces rubellomurinus
• GenBank ID: WP_045699990
• Promoter: T7 (unmodified)

Cloning Information for Gene/Insert 3

• Cloning method: Gateway Cloning
• 5′ sequencing primer: AAAAGTCTACGTGCCGAAGGC

Gene/Insert 4

• Gene/Insert name: FrbD
• Species: Streptomyces rubellomurinus
• Insert Size (bp): 834
• GenBank ID: ABB90393
• Promoter: T7 (unmodified)

Cloning Information for Gene/Insert 4

• Cloning method: Gateway Cloning
• 5′ sequencing primer: TCTACAACAAAGCCGCAGCG

Gene/Insert 5

• Gene/Insert name: FrbE
• Species: Streptomyces rubellomurinus
• Insert Size (bp): 1101
• GenBank ID: WP_045699992
• Promoter: T7 (modified)

Cloning Information for Gene/Insert 5

• Cloning method: Gateway Cloning
• 5′ sequencing primer: AGCGAAGTGTTCGAACTGCAAC

Resource Information

• Supplemental Documents:
  • pCDF-Frb-v1_addgene.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The pCDF-Frb-v1 plasmid can be propagated reliably in DH10b cells, but it is good practice to minimize the number of propagations. Upon receiving cells and growing a colony overnight in liquid culture, make a frozen glycerol stock of these Dh10b cells containing plasmid. This glycerol stock can be used to inoculate future cultures for isolating more plasmid.

Glycerol stocks can be made by mixing 600 uL of overnight culture with 400 uL of 50% (v/v) sterile glycerol and placing tube in a -80C freezer.

This plasmid should be paired with pERM2-nhpSer (#201922, which enables translational encoding of the biosynthesized non-hydrolyzable phosphoserine amino acid) and a compatible plasmid expressing protein of interest (e.g. #174076 for a sfGFP-150TAG control) in the cell line BL21(DE3) deltaSerC (#197656). This system is used to translationally incorporate non-hydrolyzable phosphoserine into target proteins at TAG amber stop codons in E coli.

This plasmid exists as a dimer. This is not expected to impact the end function of the plasmid and the depositor recommends that the plasmid should be used exactly as provided. However, please refer to the Addgene Blog post on multimers for more information: https://blog.addgene.org/plasmids-101-dimers-and-multimers

Additionally, a small insertion in the CloDF13 ori sequence has been identified in one half of the plasmid dimer. The depositor has confirmed that this has not impacted plasmid function.