pERM2-nhpSer
(Plasmid #201922)

• Purpose: Enables translational incorporation of non-hydrolyzable phosphoserine into proteins at TAG codons in E coli. Do not use for phosphoserine incorporation.
• Depositing Labs: Richard Cooley, Ryan Mehl
• Publication: Zhu et al ACS Cent Sci. 2023 Apr 10;9(4):816-835. doi: 10.1021/acscentsci.3c00191. eCollection 2023 Apr 26.

Backbone

• Vector backbone: Custom
• Backbone manufacturer: N/A
• Total vector size (bp): 9754
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Propagate with 0.5% (w/v) glucose
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: SepRS(2)
• Species: Methanococcus maripaludis
• Insert Size (bp): 1617
• Mutation: E412P, E414F, T417K, P495M, I496W, F529S
• GenBank ID: WP_011170632
• Promoter: GlnS (constitutive)
• Tag / Fusion Protein:
  • None

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CGACATCTTGGACCATTAGCCG

Gene/Insert 2

• Gene/Insert name: Sep-tRNA v2.0
• Species: Methanococcus maripaludis
• Insert Size (bp): 75
• Promoter: lpp (constitutive)

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTAGAACCGGAAGGAGCTACCG

Gene/Insert 3

• Gene/Insert name: SerB
• Species: E. coli
• Insert Size (bp): 970
• Promoter: OXB20 (constitutive)

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCCGGCAGATCTTTGTCGATC

Gene/Insert 4

• Gene/Insert name: EF-Sep
• Species: E. coli
• Insert Size (bp): 1185
• Mutation: H67R , E216N, D217G, F219Y, T229S, N274W
• Promoter: tac (lactose/IPTG inducible)

Cloning Information for Gene/Insert 4

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATACCCACGCCGAAACAAGC

Resource Information

• Supplemental Documents:
  • pERM2 - nhpSer.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid should be paired with pCDF-Frb-v1 (#201923, which enables the biosynthesis of non-hydrolyzable phosphoserine) and a compatible plasmid expressing protein of interest (e.g. #174076 for a sfGFP-150TAG control) in the cell line BL21(DE3) deltaSerC (#197656). This system is used to translationally incorporate non-hydrolyzable phosphoserine into target proteins at TAG amber stop codons in E coli.