Skip to main content
Addgene

pJRH-1187 VSVGmut
(Plasmid #201913)

Print

Ordering

This material is available to academics and nonprofits only. Availability may be limited outside the U.S. Please log in for more information.
Item Catalog # Description Quantity Price (USD)
Plasmid 201913 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCAGGS
  • Total vector size (bp) 6264
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    VSV-G (K47Q, R354A)
  • Species
    Vesicular stomatitis virus
  • Insert Size (bp)
    1533
  • Mutation
    K47Q, R354A
  • Promoter CAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTCTAGAGCCTCTGCTAACC
  • 3′ sequencing primer GCCAGAAGTCAGATGCTCAAGG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJRH-1187 VSVGmut was a gift from Jennifer Doudna (Addgene plasmid # 201913 ; http://n2t.net/addgene:201913 ; RRID:Addgene_201913)

  • For your References section:

    In vivo human T cell engineering with enveloped delivery vehicles. Hamilton JR, Chen E, Perez BS, Sandoval Espinoza CR, Kang MH, Trinidad M, Ngo W, Doudna JA. Nat Biotechnol. 2024 Jan 11. doi: 10.1038/s41587-023-02085-z. 10.1038/s41587-023-02085-z PubMed 38212493
Related items:
Commonly requested with: