Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pOPINVHH_B5-5_His
(Plasmid #201721)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201721 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pADL-23c
  • Backbone manufacturer
    Antibody Design Laboratories
  • Backbone size w/o insert (bp) 3960
  • Total vector size (bp) 4360
  • Modifications to backbone
    Introduction of restriction enzyme sites for cloning
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    VHH B5-5
  • Species
    lama glama (llama)
  • Insert Size (bp)
    390
  • Entrez Gene
    S (a.k.a. GU280_gp02, spike glycoprotein)
  • Tag / Fusion Protein
    • Hexahistidine (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GCTTCCGGCTCGTATGTTG
  • 3′ sequencing primer GTCGTCTTTCCAGACGTTAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOPINVHH_B5-5_His was a gift from Ray Owens (Addgene plasmid # 201721 ; http://n2t.net/addgene:201721 ; RRID:Addgene_201721)
  • For your References section:

    Structural and functional characterization of nanobodies that neutralize Omicron variants of SARS-CoV-2. Cornish K.. Open Biol.14230252 10.1098/rsob.230252