Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

HRE-UnaG
(Plasmid #201710)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201710 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEF/myc/cyto
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    UnaG
  • Promoter HRE-mCMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer GCACATTTCCCCGAAAAGTGC
  • 3′ sequencing primer CACGGGGGAGGGGCAAACAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HRE-UnaG was a gift from Friedemann Kiefer (Addgene plasmid # 201710 ; http://n2t.net/addgene:201710 ; RRID:Addgene_201710)
  • For your References section:

    A novel family of fluorescent hypoxia sensors reveal strong heterogeneity in tumor hypoxia at the cellular level. Erapaneedi R, Belousov VV, Schafers M, Kiefer F. EMBO J. 2016 Jan 4;35(1):102-13. doi: 10.15252/embj.201592775. Epub 2015 Nov 23. 10.15252/embj.201592775 PubMed 26598532