pGFP-mTet1s_K852E pc3915
(Plasmid #201705)

• Purpose: Expresses of GFP-tagged mTet1s_K852E in mammalian cells
• Depositing Lab: Cristina Cardoso
• Publication: Arroyo et al Nat Commun. 2022 Sep 2;13(1):5173. doi: 10.1038/s41467-022-32799-8.

Backbone

• Vector backbone: GFP-tagged construct encoding the catalitic domain of Tet1 (pc2315)
• Backbone size w/o insert (bp): 9095
• Total vector size (bp): 9095
• Modifications to backbone: To mutate lysine 852 in Tet1-CD (pc2315) to glutamate (pc3915), a sequence- and ligation-independent cloning approach was chosen
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Tet1s-K852E
• Alt name: Tet1 short isoform
• Species: M. musculus (mouse)
• Mutation: Lysine 852 mutated to glutamate
• Entrez Gene: Tet1 (a.k.a. 2510010B09Rik, Cxxc6, D10Ertd17e, LCX, mKIAA1676)
• Promoter: CAG
• Tag / Fusion Protein:
  • GFP (N terminal on backbone)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CAACGGCTGTGAGTTTGGGAGGAG
• 3′ sequencing primer: CTCCTCCCAAACTCACAGCCGTTG

Resource Information

• Supplemental Documents:
  • pc3915_cag-gfp-tets_k852e.gb
  • pc3915_pCAG-GFP-Tet1s_K852E.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry