Skip to main content
Addgene

pGFP-mTet1s_K852R pc3914
(Plasmid #201704)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201704 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    GFP-tagged construct encoding the catalitic domain of Tet1 (pc2315)
  • Backbone size w/o insert (bp) 9095
  • Total vector size (bp) 9095
  • Modifications to backbone
    To mutate lysine 852 in Tet1-CD (pc2315) to arginine (pc3914), a sequence- and ligation-independent cloning approach was chosen
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Tet1s-K852R
  • Alt name
    Tet1 short isoform
  • Species
    M. musculus (mouse)
  • Mutation
    Lysine 852 mutated to arginine
  • Entrez Gene
    Tet1 (a.k.a. 2510010B09Rik, Cxxc6, D10Ertd17e, LCX, mKIAA1676)
  • Promoter CAG
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CAACGGCTGTCGGTTTGGGAGGAG
  • 3′ sequencing primer CTCCTCCCAAACCGACAGCCGTTG
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGFP-mTet1s_K852R pc3914 was a gift from Cristina Cardoso (Addgene plasmid # 201704 ; http://n2t.net/addgene:201704 ; RRID:Addgene_201704)

  • For your References section:

    Isoform-specific and ubiquitination dependent recruitment of Tet1 to replicating heterochromatin modulates methylcytosine oxidation. Arroyo M, Hastert FD, Zhadan A, Schelter F, Zimbelmann S, Rausch C, Ludwig AK, Carell T, Cardoso MC. Nat Commun. 2022 Sep 2;13(1):5173. doi: 10.1038/s41467-022-32799-8. 10.1038/s41467-022-32799-8 PubMed 36056023
Related items: