pGFP-mVprBP pc2953
(Plasmid #201698)

• Purpose: Expresses of GFP-tagged VprBP in mammalian cells
• Depositing Lab: Cristina Cardoso
• Publication: Arroyo et al Nat Commun. 2022 Sep 2;13(1):5173. doi: 10.1038/s41467-022-32799-8.

Backbone

• Vector backbone: GFP-TDG (pc2422)
• Backbone size w/o insert (bp): 8297
• Total vector size (bp): 11553
• Modifications to backbone: To obtain a GFP-tagged VprBP (pc2953), the VprBP coding sequence was excised from the mCherry-VprBP vector (pc2954) and used to replace the TDG sequence in GFP-TDG (pc2422).
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: VprBP
• Alt name: DCAF1
• Species: M. musculus (mouse)
• Insert Size (bp): 4532
• Entrez Gene: Dcaf1 (a.k.a. B930007L02Rik, Vprbp, mKIAA0800)
• Promoter: CAG
• Tag / Fusion Protein:
  • GFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AsiSI (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: GTCTCTCTTCCCCGGACCCCTCG
• 3′ sequencing primer: CGAGGGGTCCGGGGAAGAGAGAC

Resource Information

• Supplemental Documents:
  • pc2953_pcag_egfp_m.gb
  • pc2953_pCAG-eGFP-mVprBP-IB.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry