Skip to main content
Addgene

pEJS2604_AAV-Nme2-ABE8e-i1(V106W)-U6-Rosa26
(Plasmid #201686)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201686 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    Addgene #199261 (pEJS-HZ79)
  • Total vector size (bp) 7480
  • Modifications to backbone
    Contains U6-driven sgRNA cassette
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Nme2-ABE8e-i1 (V106W)
  • Insert Size (bp)
    3987
  • Promoter U1a

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCATATCATGCTGTTCAGG
  • 3′ sequencing primer ctagagcgcttacacaaaaaacca
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.04.14.536905 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEJS2604_AAV-Nme2-ABE8e-i1(V106W)-U6-Rosa26 was a gift from Erik Sontheimer (Addgene plasmid # 201686 ; http://n2t.net/addgene:201686 ; RRID:Addgene_201686)
  • For your References section:

    Domain-inlaid Nme2Cas9 adenine base editors with improved activity and targeting scope. Bamidele N, Zhang H, Dong X, Cheng H, Gaston N, Feinzig H, Cao H, Kelly K, Watts JK, Xie J, Gao G, Sontheimer EJ. Nat Commun. 2024 Feb 17;15(1):1458. doi: 10.1038/s41467-024-45763-5. 10.1038/s41467-024-45763-5 PubMed 38368418