pLenti-hSFTPCpromoter(2kb)-EGFP-EF1a-TagRFP
(Plasmid
#201681)
-
PurposeLentiviral vector for human SFTPC promoter (2kb)-driven expression of EGFP and EF1a-driven TagRFP expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 201681 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHAGE
- Backbone size w/o insert (bp) 8196
- Total vector size (bp) 10441
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameSFTPC promoter region (2kb upstream)
-
SpeciesH. sapiens (human); Homo sapiens
-
Insert Size (bp)2235
-
GenBank IDNC_000008.11
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer tagcggccacagagcttgtgacagc
- 3′ sequencing primer ctgcaggtgctatgctctcctctcc (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameTagRFP
-
Insert Size (bp)714
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.08.30.555522 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-hSFTPCpromoter(2kb)-EGFP-EF1a-TagRFP was a gift from Emma Rawlins (Addgene plasmid # 201681 ; http://n2t.net/addgene:201681 ; RRID:Addgene_201681) -
For your References section:
A novel human fetal lung-derived alveolar organoid model reveals mechanisms of surfactant protein C maturation relevant to interstitial lung disease. Lim K, Rutherford EN, Sun D, Van den Boomen DJH, Edgar JR, Bang JH, Matesic LE, Lee JH, Lehner PJ, Marciniak SJ, Rawlins EL, Dickens JA. bioRxiv [Preprint]. 2023 Sep 4:2023.08.30.555522. doi: 10.1101/2023.08.30.555522. 10.1101/2023.08.30.555522 PubMed 37693487