pRN3P_T3_ABE8e_IVT
(Plasmid #201676)

• Purpose: Plasmid to be used as DNA template for in vitro RNA transcription of the ABE8e base editor (A to G) by T3 RNA polymerase. The plasmid contains optimised 5'UTR and 3'UTR to improve protein expression.
• Depositing Lab: Timo Otonkoski
• Publication: Jalil et al American J of Human Genetics

Backbone

• Vector backbone: pRN3P
• Backbone manufacturer: Torres-Padilla et al., 2007
• Backbone size w/o insert (bp): 3202
• Total vector size (bp): 8054
• Vector type: CRISPR ; Vector for in-vitro transcription

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Grow solid and liquid cultures at 30°C if there are issues with plasmid stability.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ecTadA(8e)-nSpCas9
• Alt name: Adenine Base Editor 8e
• Insert Size (bp): 4852
• Promoter: T3 promoter

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: cagctatgaccatgattacgcc
• 3′ sequencing primer: gactcactatagggcgaattgg

Resource Information

• Supplemental Documents:
  • Depositor Sequence
• A portion of this plasmid was derived from a plasmid made by: ABE8e was a gift from David Liu (Addgene plasmid # 138489 ; http://n2t.net/addgene:138489 ; RRID:Addgene_138489). The in-vitro transcription backbone was published by Torres-Padilla et al., 2007.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Phage-assisted evolution of an adenine base editor with improved Cas domain compatibility and activity. Richter MF, Zhao KT, Eton E, Lapinaite A, Newby GA, Thuronyi BW, Wilson C, Koblan LW, Zeng J, Bauer DE, Doudna JA and Liu DR. Nat Biotechnol (2020) 10.1038/s41587-020-0453-z

Please note that the Addgene NGS result has ambiguous bases in the 3'UTR due to difficulty sequencing through the poly A region.