pCMV6-AN-HA_WT POLH
(Plasmid
#201671)
-
PurposeExpression of WT DNA polymerase eta with an N-terminal HA tag in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 201671 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCMV6-AN-HA
-
Backbone manufacturerOrigene
- Total vector size (bp) 8074
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePolymerase eta
-
SpeciesH. sapiens (human)
-
MutationCoding sequence has been optimised for expression in human cells
-
Entrez GenePOLH (a.k.a. RAD30, RAD30A, XP-V, XPV)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AsiSI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer CAGGAAACAGCTATGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV6-AN-HA_WT POLH was a gift from Roger Woodgate (Addgene plasmid # 201671 ; http://n2t.net/addgene:201671 ; RRID:Addgene_201671) -
For your References section:
Ubiquitin mediates the physical and functional interaction between human DNA polymerases eta and iota. McIntyre J, Vidal AE, McLenigan MP, Bomar MG, Curti E, McDonald JP, Plosky BS, Ohashi E, Woodgate R. Nucleic Acids Res. 2013 Feb 1;41(3):1649-60. doi: 10.1093/nar/gks1277. Epub 2012 Dec 16. 10.1093/nar/gks1277 PubMed 23248005