pCMV6-AN-HA_WT POLH
(Plasmid #201671)

• Purpose: Expression of WT DNA polymerase eta with an N-terminal HA tag in mammalian cells
• Depositing Lab: Roger Woodgate
• Publication: McIntyre et al Nucleic Acids Res. 2013 Feb 1;41(3):1649-60. doi: 10.1093/nar/gks1277. Epub 2012 Dec 16.

Backbone

• Vector backbone: pCMV6-AN-HA
• Backbone manufacturer: Origene
• Total vector size (bp): 8074
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Polymerase eta
• Species: H. sapiens (human)
• Mutation: Coding sequence has been optimised for expression in human cells
• Entrez Gene: POLH (a.k.a. RAD30, RAD30A, XP-V, XPV)
• Promoter: CMV
• Tag / Fusion Protein:
  • HA (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AsiSI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: TAATACGACTCACTATAGGG
• 3′ sequencing primer: CAGGAAACAGCTATGAC

Resource Information

• Supplemental Documents:
  • pCMV6-AN-HA_WT POLH.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry