Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

LENTICRISPR-PFKM_sgRNA2
(Plasmid #201611)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201611 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    lentiCRISPR v2
  • Backbone manufacturer
    Feng Zhang, Addgene #52961
  • Vector type
    Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PFKM
  • gRNA/shRNA sequence
    AAGGACTTTCGGGAACGAGA
  • Species
    H. sapiens (human)
  • Entrez Gene
    PFKM (a.k.a. ATP-PFK, GSD7, PFK-1, PFK-A, PFK1, PFKA, PFKX, PPP1R122)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (unknown if destroyed)
  • 3′ cloning site BsmBI (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LENTICRISPR-PFKM_sgRNA2 was a gift from Alexis Jourdain & Vamsi Mootha (Addgene plasmid # 201611 ; http://n2t.net/addgene:201611 ; RRID:Addgene_201611)
  • For your References section:

    Loss of LUC7L2 and U1 snRNP subunits shifts energy metabolism from glycolysis to OXPHOS. Jourdain AA, Begg BE, Mick E, Shah H, Calvo SE, Skinner OS, Sharma R, Blue SM, Yeo GW, Burge CB, Mootha VK. Mol Cell. 2021 May 6;81(9):1905-1919.e12. doi: 10.1016/j.molcel.2021.02.033. Epub 2021 Apr 13. 10.1016/j.molcel.2021.02.033 PubMed 33852893