LENTICRISPR-ENO1_sgRNA1
(Plasmid
#201592)
-
PurposeCRISPR/Cas9-mediated gene knock-out
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 201592 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonelentiCRISPR v2
-
Backbone manufacturerFeng Zhang, Addgene #52961
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameENO1
-
gRNA/shRNA sequenceGAGTCGGTGCAGCAAACTTCA
-
SpeciesH. sapiens (human)
-
Entrez GeneENO1 (a.k.a. ENO1-IT1, ENO1L1, HEL-S-17, MPB1, NNE, PPH)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (unknown if destroyed)
- 3′ cloning site BsmBI (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LENTICRISPR-ENO1_sgRNA1 was a gift from Alexis Jourdain & Vamsi Mootha (Addgene plasmid # 201592 ; http://n2t.net/addgene:201592 ; RRID:Addgene_201592) -
For your References section:
Loss of LUC7L2 and U1 snRNP subunits shifts energy metabolism from glycolysis to OXPHOS. Jourdain AA, Begg BE, Mick E, Shah H, Calvo SE, Skinner OS, Sharma R, Blue SM, Yeo GW, Burge CB, Mootha VK. Mol Cell. 2021 May 6;81(9):1905-1919.e12. doi: 10.1016/j.molcel.2021.02.033. Epub 2021 Apr 13. 10.1016/j.molcel.2021.02.033 PubMed 33852893