LENTICRISPR-ALDOA_sgRNA2
(Plasmid
#201591)
-
PurposeCRISPR/Cas9-mediated gene knock-out
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 201591 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonelentiCRISPR v2
-
Backbone manufacturerFeng Zhang, Addgene #52961
-
Vector typeLentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameALDOA
-
gRNA/shRNA sequenceAGGATGACACCCCCAATGCA
-
SpeciesH. sapiens (human)
-
Entrez GeneALDOA (a.k.a. ALDA, GSD12, HEL-S-87p)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (unknown if destroyed)
- 3′ cloning site BsmBI (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LENTICRISPR-ALDOA_sgRNA2 was a gift from Alexis Jourdain & Vamsi Mootha (Addgene plasmid # 201591 ; http://n2t.net/addgene:201591 ; RRID:Addgene_201591) -
For your References section:
Salvage of ribose from uridine or RNA supports glycolysis in nutrient-limited conditions. Skinner OS, Blanco-Fernandez J, Goodman RP, Kawakami A, Shen H, Kemeny LV, Joesch-Cohen L, Rees MG, Roth JA, Fisher DE, Mootha VK, Jourdain AA. Nat Metab. 2023 May;5(5):765-776. doi: 10.1038/s42255-023-00774-2. Epub 2023 May 17. 10.1038/s42255-023-00774-2 PubMed 37198474