Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

EGFP in pDBEcR-pIND(SP1)/Bla
(Plasmid #201557)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201557 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pDBEcR/Bla
  • Total vector size (bp) 8039
  • Vector type
    Mammalian Expression, Unspecified ; sleeping beauty transposon
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DBEcR and EGFP
  • Species
    a hybrid Drosophila/Bombyx ecdysone receptor
  • Promoter EF1a and pIMD(SP1)
  • Tags / Fusion Proteins
    • DBEcR-myc (C terminal on insert)
    • FLAG-EGFP (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer 5'-AGCCTCTAGGGTCGACCTCGACGGAT-3'
  • 3′ sequencing primer CCTGCACCTGAGGAGTGAATTCTTATCATGTCTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EGFP in pDBEcR-pIND(SP1)/Bla was a gift from Randy Poon (Addgene plasmid # 201557 ; http://n2t.net/addgene:201557 ; RRID:Addgene_201557)
  • For your References section:

    A robust dual gene ON-OFF toggle directed by two independent promoter-degron pairs. Yeung TK, Kim S, Ma HT, Poon RYC. J Cell Sci. 2023 Apr 15;136(8):jcs260754. doi: 10.1242/jcs.260754. Epub 2023 Apr 19. 10.1242/jcs.260754 PubMed 36995025