pHIE323-LPIV Puro-P2A-miRFP720 ZF6x12-C-DsRed-Express2(x6) phEF1α-BlastR
(Plasmid
#201539)
-
PurposeLanding pad integration vector used to generate ZF6 synTF reporter line (HIE156), assembled with pPD1178 (destination vector), pHIE324-329 (TUPV1-6), pHIE280 (TUPV7), pPD1157 (linker)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 201539 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepD1178 Destination Vector
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namePuromycinR-P2A-miRFP720
-
SpeciesH. sapiens (human)
- Promoter None
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer GAGATTATCAAAAAGGATCTTCACCTAGATCC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameZF6x12-C-DsRed-Express2(x6)
-
SpeciesH. sapiens (human)
- Promoter ZF6x12(C)_YB_TATA Minimal Promoter
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer gacagaatcatagaacggcctgg (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameBlasticidinR
-
SpeciesH. sapiens (human)
- Promoter hEF1α
Cloning Information for Gene/Insert 3
- Cloning method Restriction Enzyme
- 5′ cloning site BpiI (destroyed during cloning)
- 3′ cloning site BpiI (destroyed during cloning)
- 5′ sequencing primer gaatctggtggcaccttcgcg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2023.04.29.538810 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHIE323-LPIV Puro-P2A-miRFP720 ZF6x12-C-DsRed-Express2(x6) phEF1α-BlastR was a gift from Joshua Leonard (Addgene plasmid # 201539 ; http://n2t.net/addgene:201539 ; RRID:Addgene_201539) -
For your References section:
Enhancing extracellular vesicle cargo loading and functional delivery by engineering protein-lipid interactions. Peruzzi JA, Gunnels TF, Edelstein HI, Lu P, Baker D, Leonard JN, Kamat NP. Nat Commun. 2024 Jul 4;15(1):5618. doi: 10.1038/s41467-024-49678-z. 10.1038/s41467-024-49678-z PubMed 38965227