NbV5-eGFP
(Plasmid
#201473)
-
PurposeIndirect microscopy/imaging of V5-tagged protein
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 201473 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFPN1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNbV5-eGFP
-
SpeciesSynthetic
-
Insert Size (bp)1110
- Promoter CMV
-
Tag
/ Fusion Protein
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CMV-F
- 3′ sequencing primer CGTCGCCGTCCAGCTCGACCAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySynthetic
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NbV5-eGFP was a gift from Patrick Giguère (Addgene plasmid # 201473 ; http://n2t.net/addgene:201473 ; RRID:Addgene_201473) -
For your References section:
Development of a V5-tag-directed nanobody and its implementation as an intracellular biosensor of GPCR signalling. Zeghal M, Matte K, Venes A, Patel S, Laroche G, Sarvan S, Joshi M, Rain JC, Couture JF, Giguere PM. J Biol Chem. 2023 Jul 28:105107. doi: 10.1016/j.jbc.2023.105107. 10.1016/j.jbc.2023.105107 PubMed 37517699