pGEX-6P-1_WT RAD23A
(Plasmid #201456)

• Purpose: Expresses human RAD23A with an N-terminal GST tag in E. coli
• Depositing Lab: Roger Woodgate
• Publication: Ashton et al J Mol Biol. 2023 Nov 5:168353. doi: 10.1016/j.jmb.2023.168353.

Backbone

• Vector backbone: pGEX-6P-1
• Backbone size w/o insert (bp): 4984
• Total vector size (bp): 6073
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: UV excision repair protein RAD23 homolog A
• Species: H. sapiens (human)
• Mutation: Coding sequence has been optimised for expression in E. coli
• Entrez Gene: RAD23A (a.k.a. HHR23A, HR23A)
• Promoter: tac promoter
• Tag / Fusion Protein:
  • GST (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: GGGCTGGCAAGCCACGTTTGGTG
• 3′ sequencing primer: GCTTACAGACAAGCTGTGACC

Resource Information

• Supplemental Documents:
  • pGEX-6P-1_WT RAD23A.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

GST tag is cleavable with rhinovirus 3C and PreScission proteases