Skip to main content
Addgene

pGEX-6P-1_WT RAD23A
(Plasmid #201456)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201456 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGEX-6P-1
  • Backbone size w/o insert (bp) 4984
  • Total vector size (bp) 6073
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    UV excision repair protein RAD23 homolog A
  • Species
    H. sapiens (human)
  • Mutation
    Coding sequence has been optimised for expression in E. coli
  • Entrez Gene
    RAD23A (a.k.a. HHR23A, HR23A)
  • Promoter tac promoter
  • Tag / Fusion Protein
    • GST (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
  • 3′ sequencing primer GCTTACAGACAAGCTGTGACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

GST tag is cleavable with rhinovirus 3C and PreScission proteases

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX-6P-1_WT RAD23A was a gift from Roger Woodgate (Addgene plasmid # 201456 ; http://n2t.net/addgene:201456 ; RRID:Addgene_201456)
  • For your References section:

    A novel interaction between RAD23A/B and Y-family DNA polymerases. Ashton NW, Jaiswal N, Cestari Moreno N, Semenova IV, D'Orlando DA, Teatin Latancia M, McIntyre J, Woodgate R, Bezsonova I. J Mol Biol. 2023 Nov 5:168353. doi: 10.1016/j.jmb.2023.168353. 10.1016/j.jmb.2023.168353 PubMed 37935254