Skip to main content
Addgene

Dhh1 426-506-EGFP
(Plasmid #201431)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201431 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    MTTH-EGFP
  • Backbone size w/o insert (bp) 7400
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Dhh1
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    186
  • Mutation
    aa 426-506 only
  • Entrez Gene
    DHH1 (a.k.a. YDL160C)
  • Promoter tac
  • Tags / Fusion Proteins
    • MBP, TEV (N terminal on backbone)
    • EGFP, TEV, 6xHis (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GGTCGTCAGACTGTCGATGAAGCC
  • 3′ sequencing primer CAGGAAACAGCTATGACC
    • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    gene insert was a gift from Roy Parker (University of Colorado Boulder)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Dhh1 426-506-EGFP was a gift from Michael Rosen (Addgene plasmid # 201431 ; http://n2t.net/addgene:201431 ; RRID:Addgene_201431)

  • For your References section:

    Quantitative reconstitution of yeast RNA processing bodies. Currie SL, Xing W, Muhlrad D, Decker CJ, Parker R, Rosen MK. Proc Natl Acad Sci U S A. 2023 Apr 4;120(14):e2214064120. doi: 10.1073/pnas.2214064120. Epub 2023 Mar 27. 10.1073/pnas.2214064120 PubMed 36972455
Related items: