Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Dhh1-EGFP
(Plasmid #201418)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201418 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    MTTH-EGFP
  • Backbone size w/o insert (bp) 7400
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Dhh1
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    1518
  • Entrez Gene
    DHH1 (a.k.a. YDL160C)
  • Promoter tac
  • Tags / Fusion Proteins
    • MBP, TEV (N terminal on backbone)
    • EGFP, TEV, 6xHis (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GGTCGTCAGACTGTCGATGAAGCC
  • 3′ sequencing primer CAGGAAACAGCTATGACC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    gene insert was a gift from Roy Parker (University of Colorado Boulder)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Dhh1-EGFP was a gift from Michael Rosen (Addgene plasmid # 201418 ; http://n2t.net/addgene:201418 ; RRID:Addgene_201418)
  • For your References section:

    Quantitative reconstitution of yeast RNA processing bodies. Currie SL, Xing W, Muhlrad D, Decker CJ, Parker R, Rosen MK. Proc Natl Acad Sci U S A. 2023 Apr 4;120(14):e2214064120. doi: 10.1073/pnas.2214064120. Epub 2023 Mar 27. 10.1073/pnas.2214064120 PubMed 36972455