Dhh1-EGFP
(Plasmid #201418)

• Purpose: Bacterial protein expression of Dhh1
• Depositing Lab: Michael Rosen
• Publication: Currie et al Proc Natl Acad Sci U S A. 2023 Apr 4;120(14):e2214064120. doi: 10.1073/pnas.2214064120. Epub 2023 Mar 27.

Backbone

• Vector backbone: MTTH-EGFP
• Backbone size w/o insert (bp): 7400
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Dhh1
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 1518
• Entrez Gene: DHH1 (a.k.a. YDL160C)
• Promoter: tac
• Tags / Fusion Proteins:
  • MBP, TEV (N terminal on backbone)
  • EGFP, TEV, 6xHis (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: GGTCGTCAGACTGTCGATGAAGCC
• 3′ sequencing primer: CAGGAAACAGCTATGACC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: gene insert was a gift from Roy Parker (University of Colorado Boulder)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry