PB-TAC-ERP2-(N-HA)KRAS_G12D
(Plasmid #201254)

• Purpose: Dox-inducible overexpression of HA-tagged KRASG12D and mCherry in human cells
• Depositing Lab: Alexander Kleger
• Publication: Breunig et al Cell Stem Cell. 2021 Jun 3;28(6):1105-1124.e19. doi: 10.1016/j.stem.2021.03.005. Epub 2021 Apr 28.

Backbone

• Vector backbone: PB-TAC-ERP2
• Backbone manufacturer: Knut Woltjen, Addgene plasmid #80478
• Backbone size w/o insert (bp): 10723
• Total vector size (bp): 11347
• Modifications to backbone: None
• Vector type: Mammalian Expression ; piggyBac transposon
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: KRAS
• Alt name: Kirsten rat sarcoma viral oncogene
• Species: H. sapiens (human)
• Insert Size (bp): 624
• Mutation: changed Gly (G) 12 to Asp (D)
• GenBank ID: NM_001369787.1 NM_004985.5
• Entrez Gene: KRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras, c-Ki-ras2)
• Promoter: TRE
• Tag / Fusion Protein:
  • HA-Tag (N terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: aaaaagcaggcttcactagtgtctttcataagcttatgtatccatatgatgtgcccgact
• 3′ sequencing primer: agaaagctgggtgtgacacacattccacagggt

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pBABE-KRAS G12D, Addgene 58902, Channing Der lab

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry