pCMV-µLight
(Plasmid
#201225)
-
PurposeExpress muLight biosensor in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 201225 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV
- Backbone size w/o insert (bp) 3988
- Total vector size (bp) 6232
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameµLight
-
Alt namemuLight
-
SpeciesSynthetic
-
Insert Size (bp)2244
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ggtaggcgtgtacggtggg
- 3′ sequencing primer gctattgctttatttgtaaccattataagctgcaataaac
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-µLight was a gift from Lin Tian (Addgene plasmid # 201225 ; http://n2t.net/addgene:201225 ; RRID:Addgene_201225) -
For your References section:
Unlocking opioid neuropeptide dynamics with genetically encoded biosensors. Dong C, Gowrishankar R, Jin Y, He XJ, Gupta A, Wang H, Sayar-Atasoy N, Flores RJ, Mahe K, Tjahjono N, Liang R, Marley A, Or Mizuno G, Lo DK, Sun Q, Whistler JL, Li B, Gomes I, Von Zastrow M, Tejeda HA, Atasoy D, Devi LA, Bruchas MR, Banghart MR, Tian L. Nat Neurosci. 2024 Jul 15. doi: 10.1038/s41593-024-01697-1. 10.1038/s41593-024-01697-1 PubMed 39009835