pCDNA3.1-ADGRL3-Flag
(Plasmid
#201218)
-
PurposepCDNA3.1 with kozak (GCC), ADGRL3 and C-terminal Flag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 201218 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCDNA3.1
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 10042
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameADGRL3
-
Alt nameLphn3
-
Alt nameLatrophilin-3
-
SpeciesM. musculus (mouse)
-
Entrez GeneAdgrl3 (a.k.a. 5430402I23Rik, CIRL-3, D130075K09Rik, Gm1379, LEC3, Lphn3, mKIAA0768)
- Promoter CMV
-
Tag
/ Fusion Protein
- Flag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDNA3.1-ADGRL3-Flag was a gift from Jonathan Javitch (Addgene plasmid # 201218 ; http://n2t.net/addgene:201218 ; RRID:Addgene_201218) -
For your References section:
Disentangling autoproteolytic cleavage from tethered agonist-dependent activation of the adhesion receptor ADGRL3. Perry-Hauser NA, VanDyck MW, Lee KH, Shi L, Javitch JA. J Biol Chem. 2022 Dec;298(12):102594. doi: 10.1016/j.jbc.2022.102594. Epub 2022 Oct 14. 10.1016/j.jbc.2022.102594 PubMed 36244455