Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCDNA3.1-Kozak-SP-SNAPf-lk-EK-ADGRL3-CTF
(Plasmid #201217)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201217 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCDNA3.1
  • Backbone size w/o insert (bp) 5248
  • Total vector size (bp) 7906
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ADGRL3
  • Alt name
    Lphn3
  • Alt name
    Latrophilin-3
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2523
  • Entrez Gene
    Adgrl3 (a.k.a. 5430402I23Rik, CIRL-3, D130075K09Rik, Gm1379, LEC3, Lphn3, mKIAA0768)
  • Promoter CMV
  • Tags / Fusion Proteins
    • SNAP (N terminal on insert)
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDNA3.1-Kozak-SP-SNAPf-lk-EK-ADGRL3-CTF was a gift from Jonathan Javitch (Addgene plasmid # 201217 ; http://n2t.net/addgene:201217 ; RRID:Addgene_201217)
  • For your References section:

    Disentangling autoproteolytic cleavage from tethered agonist-dependent activation of the adhesion receptor ADGRL3. Perry-Hauser NA, VanDyck MW, Lee KH, Shi L, Javitch JA. J Biol Chem. 2022 Dec;298(12):102594. doi: 10.1016/j.jbc.2022.102594. Epub 2022 Oct 14. 10.1016/j.jbc.2022.102594 PubMed 36244455