SpyCatcher-P-Domain
(Plasmid #201193)

• Purpose: Expresses furin P-domain genetically fused to SpyCatcher001 in bacteria
• Depositing Lab: Vesa Hytönen
• Publication: Lampinen et al Nanoscale Adv. 2024 Oct 9;6(24):6239-52. doi: 10.1039/d4na00483c.

Backbone

• Vector backbone: pET-11b
• Backbone size w/o insert (bp): 5592
• Total vector size (bp): 6318
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SpyCatcher-P-Domain
• Species: H. sapiens (human), Synthetic
• Insert Size (bp): 724
• GenBank ID: X17094.1
• Promoter: T7
• Tags / Fusion Proteins:
  • SpyCatcher001 (N terminal on insert)
  • HisTag (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: BlpI (not destroyed)
• 5′ sequencing primer: GGAATTGTTATCCGCTCAC
• 3′ sequencing primer: TCCTCCTTTCAGCAAAAAACCCC

Resource Information

• Supplemental Documents:
  • GOAL_pET-11b_SpyCatcher_PDomain.gb
• A portion of this plasmid was derived from a plasmid made by: The gene was syntesized and cloned by Genscript.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note insert is codon optimized for insect cell expression.

Original publication:
Zakeri B, Fierer JO, Celik E, Chittock EC, Schwarz-Linek U, Moy VT, Howarth M. Peptide tag forming a rapid covalent bond to a protein, through engineering a bacterial adhesin. Proc Natl Acad Sci U S A. 2012 Mar 20;109(12):E690-7. doi: 10.1073/pnas.1115485109. Epub 2012 Feb 24. PMID: 22366317; PMCID: PMC3311370.