pRha-ABE8e-SpCas9-NG
(Plasmid
#201190)
-
PurposeExpresses the base editor ABE8e-SpCas9-NG in bacterial cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 201190 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepD881-SR
-
Backbone manufacturerAtum
- Total vector size (bp) 7095
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameABE8e-SpCas9-NG
-
SpeciesSynthetic
-
Insert Size (bp)4845
- Promoter pRhaBAD
-
Tags
/ Fusion Proteins
- 8xHIS (N terminal on insert)
- BP-NLS (N terminal on insert)
- BP-NLS (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGAATTCAGGCGCTTTTTAG
- 3′ sequencing primer CAGTGAGTTGATTGCAGTCC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byDavid Liu's lab at Broad Institute
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRha-ABE8e-SpCas9-NG was a gift from Jonathan Yen (Addgene plasmid # 201190 ; http://n2t.net/addgene:201190 ; RRID:Addgene_201190) -
For your References section:
Potent and uniform fetal hemoglobin induction via base editing. Mayuranathan T, Newby GA, Feng R, Yao Y, Mayberry KD, Lazzarotto CR, Li Y, Levine RM, Nimmagadda N, Dempsey E, Kang G, Porter SN, Doerfler PA, Zhang J, Jang Y, Chen J, Bell HW, Crossley M, Bhoopalan SV, Sharma A, Tisdale JF, Pruett-Miller SM, Cheng Y, Tsai SQ, Liu DR, Weiss MJ, Yen JS. Nat Genet. 2023 Jul;55(7):1210-1220. doi: 10.1038/s41588-023-01434-7. Epub 2023 Jul 3. 10.1038/s41588-023-01434-7 PubMed 37400614