pLenti-dSaCas9-KRAB-gRNA-TRE-blast
(Plasmid #201151)

• Purpose: Lentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.
• Depositing Lab: Moshe Szyf
• Publication: CRISPRi plasmids for reduced leakiness of doxycycline-inducible tight TRE promoter (unpublished)

Backbone

• Vector backbone: pLenti-dSaCas9-KRAB-blast
• Backbone manufacturer: Addgene #191654
• Modifications to backbone: Cloned the expression casette including the U6 promoter, guide RNA targeting the tight TRE promoter, and guide RNA scaffold into an EcoRI site in the backbone.
• Vector type: Lentiviral, CRISPR
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: SadCas9-KRAB
• Alt name: KRAB-SadCas9
• Alt name: dSaCas9-KRAB
• Species: Synthetic; S. aureus
• Tag / Fusion Protein:
  • HA (N terminal on insert)

Gene/Insert 2

• Gene/Insert name: gRNA-TRE
• Species: Synthetic; S. aureus
• Mutation: gRNA sequence: ATCAGTGATAGAGAACGTATG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry