pCB11
(Plasmid
#201111)
-
PurposepSR58.6 (Addgene plasmid #63176) modified to include the tetA gene upstream of sfGFP.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 201111 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepProTet.E333
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 2000
- Total vector size (bp) 5145
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameCcaR
-
SpeciesSynechocystis sp. 6803
-
Insert Size (bp)704
- Promoter J23100
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer AAATAGGCGTATCACGAGGC
- 3′ sequencing primer GAGCGACACGAATTATGCAG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nametetA(C)
-
SpeciesEscherichia coli
-
Insert Size (bp)1191
-
MutationC-to-T transition at pos. no. 1049 of tetA(C) leading to T350I muation in TetA(C)
-
GenBank IDAAB59735.1
- Promoter PcpcG2-172
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer CTGAAGGGGTGAACAGGTCTGG
- 3′ sequencing primer TCCAGTTCCACCAGAATAGG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert namesfGFP
-
Alt nameSuperfolder GFP
-
SpeciesSynthetic
-
Insert Size (bp)720
- Promoter PcpcG2-172
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer ctataccttgtctgcctccc
- 3′ sequencing primer GCAGGTCGACTCTAGAGGAT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bytetA insert from Hans-Martin Fischer (Addgene #74110). Plasmid backbone and CcaR and sfGFP inserts are from Jeffrey Tabor (Addgene #63176).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2022.10.28.514305 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCB11 was a gift from Mary Dunlop (Addgene plasmid # 201111 ; http://n2t.net/addgene:201111 ; RRID:Addgene_201111) -
For your References section:
Deep model predictive control of gene expression in thousands of single cells. Lugagne JB, Blassick CM, Dunlop MJ. Nat Commun. 2024 Mar 8;15(1):2148. doi: 10.1038/s41467-024-46361-1. 10.1038/s41467-024-46361-1 PubMed 38459057