pCB11
(Plasmid #201111)

• Purpose: pSR58.6 (Addgene plasmid #63176) modified to include the tetA gene upstream of sfGFP.
• Depositing Lab: Mary Dunlop
• Publication: Lugagne et al Nat Commun. 2024 Mar 8;15(1):2148. doi: 10.1038/s41467-024-46361-1.

Backbone

• Vector backbone: pProTet.E333
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 2000
• Total vector size (bp): 5145
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: CcaR
• Species: Synechocystis sp. 6803
• Insert Size (bp): 704
• Promoter: J23100

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: AAATAGGCGTATCACGAGGC
• 3′ sequencing primer: GAGCGACACGAATTATGCAG

Gene/Insert 2

• Gene/Insert name: tetA(C)
• Species: Escherichia coli
• Insert Size (bp): 1191
• Mutation: C-to-T transition at pos. no. 1049 of tetA(C) leading to T350I muation in TetA(C)
• GenBank ID: AAB59735.1
• Promoter: PcpcG2-172

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTGAAGGGGTGAACAGGTCTGG
• 3′ sequencing primer: TCCAGTTCCACCAGAATAGG

Gene/Insert 3

• Gene/Insert name: sfGFP
• Alt name: Superfolder GFP
• Species: Synthetic
• Insert Size (bp): 720
• Promoter: PcpcG2-172

Cloning Information for Gene/Insert 3

• Cloning method: Unknown
• 5′ sequencing primer: ctataccttgtctgcctccc
• 3′ sequencing primer: GCAGGTCGACTCTAGAGGAT

Resource Information

• Supplemental Documents:
  • pcb011-ccar-tcr-sfgfp.gb
• A portion of this plasmid was derived from a plasmid made by: tetA insert from Hans-Martin Fischer (Addgene #74110). Plasmid backbone and CcaR and sfGFP inserts are from Jeffrey Tabor (Addgene #63176).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2022.10.28.514305 for bioRxiv preprint.