pET-28a(+)-6xHis-TEV-ORF9c
(Plasmid
#201023)
-
PurposeBacterial expression of codon optimized SARS-CoV-2 ORF9c tagged with an N-terminus His tag followed by a TEV cleavage site.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 201023 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepET28a(+)
- Backbone size w/o insert (bp) 5369
- Total vector size (bp) 5558
-
Modifications to backboneInsertion of PRF9c
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameopen reading frame 9c
-
Alt nameORF9c
-
SpeciesSynthetic; Severe acute respiratory syndrome coronavirus 2
-
Insert Size (bp)222
-
MutationGene insert is codon optimized for Ecoli.
- Promoter T7/LacO
-
Tag
/ Fusion Protein
- 6xHis-TEV (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer taatacgactcactataggg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-28a(+)-6xHis-TEV-ORF9c was a gift from Sharon Rozovsky (Addgene plasmid # 201023 ; http://n2t.net/addgene:201023 ; RRID:Addgene_201023) -
For your References section:
Selenoprotein S Interacts with the Replication and Transcription Complex of SARS-CoV-2 by Binding nsp7. Ghelichkhani F, Gonzalez FA, Kapitonova MA, Rozovsky S. J Mol Biol. 2023 Apr 15;435(8):168008. doi: 10.1016/j.jmb.2023.168008. Epub 2023 Feb 10. 10.1016/j.jmb.2023.168008 PubMed 36773692