pETDuet-1-6xHis-TEV-Nsp8
(Plasmid #201022)

• Purpose: Bacterial expression of codon optimized SARS-CoV-2 nsp8 tagged with an N-terminus His-tag followed by a TEV protease cleavage site.
• Depositing Lab: Sharon Rozovsky
• Publication: Ghelichkhani et al J Mol Biol. 2023 Apr 15;435(8):168008. doi: 10.1016/j.jmb.2023.168008. Epub 2023 Feb 10.

Backbone

• Vector backbone: pETDuet-1
• Backbone manufacturer: Novagen
• Backbone size w/o insert (bp): 5420
• Total vector size (bp): 6077
• Modifications to backbone: Insertion of 6xHis-TEV-Nsp8
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: non-structural protein 8
• Alt name: nsp8
• Species: Synthetic; Severe acute respiratory syndrome coronavirus 2
• Insert Size (bp): 657
• Mutation: Gene insert is codon optimized for Ecoli.
• Entrez Gene: ORF1ab (a.k.a. GU280_gp01)
• Promoter: T7/LacO
• Tag / Fusion Protein:
  • 6xHis-TEV (N terminal on backbone)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: taatacgactcactataggg
• 3′ sequencing primer: gctagttattgctcagcgg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry