Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

CMV-synaptophysin-Lime
(Plasmid #201016)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 201016 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCDNA3
  • Total vector size (bp) 6780
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Synaptophysin-Lime
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1728
  • Entrez Gene
    Syp (a.k.a. A230093K24Rik, Syn, p38)
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CMV-synaptophysin-Lime was a gift from Jaime de Juan-Sanz (Addgene plasmid # 201016 ; http://n2t.net/addgene:201016 ; RRID:Addgene_201016)
  • For your References section:

    Rational Engineering of an Improved Genetically Encoded pH Sensor Based on Superecliptic pHluorin. Shen Y, Wen Y, Sposini S, Vishwanath AA, Abdelfattah AS, Schreiter ER, Lemieux MJ, de Juan-Sanz J, Perrais D, Campbell RE. ACS Sens. 2023 Aug 25;8(8):3014-3022. doi: 10.1021/acssensors.3c00484. Epub 2023 Jul 23. 10.1021/acssensors.3c00484 PubMed 37481776